Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.078613 |
Chromosome: | chromosome 10 |
Location: | 3999114 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g448950 | EEP3 | Exonuclease-Endonuclease-Phosphatase superfamily protein; (1 of 1) K18764 - nocturnin [EC:3.1.13.4] (CCRN4L) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGACCTGATGTTACGACTCAGGCAAGCA |
Internal bar code: | GAGTACGCCTTGGTAAGCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 745 |
LEAP-Seq percent confirming: | 80.0601 |
LEAP-Seq n confirming: | 1333 |
LEAP-Seq n nonconfirming: | 332 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCTGCTCTGTATGTTGGC |
Suggested primer 2: | GCAGTCTTGCACAAGCCATA |