| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.078639 |
| Chromosome: | chromosome 6 |
| Location: | 8642204 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309300 | KSGA,RRM7,KSGA1 | Dimethyl transferase for modification of 16S rRNA; (1 of 1) 2.1.1.182 - 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGATGTCGCGCAGGATGGTGTCGTCCATC |
| Internal bar code: | TGAGAAGCTTTGAGTGGAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 245 |
| LEAP-Seq percent confirming: | 77.7672 |
| LEAP-Seq n confirming: | 815 |
| LEAP-Seq n nonconfirming: | 233 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGTGTGATGCCGTGTGTG |
| Suggested primer 2: | GATGGAGAAAGGGAAGGAGG |