Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.078814 |
Chromosome: | chromosome 17 |
Location: | 1427922 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g706650 | VPS22 | Subunit of ESCRT-II complex; (1 of 1) K12188 - ESCRT-II complex subunit VPS22 (SNF8, EAP30) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAGCTGAAGAAAGGTGGCGCTCCGCTCA |
Internal bar code: | TAGTCCTACGGAGCTCCGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1072 |
LEAP-Seq percent confirming: | 99.6456 |
LEAP-Seq n confirming: | 6185 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTACACTCGTGCGCTGTTG |
Suggested primer 2: | AACTCGCCACACCCATCTAC |