| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.078867 |
| Chromosome: | chromosome 12 |
| Location: | 2371961 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507400 | LCS3,CGL105 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCCGCCCAACCGCCTGCCCGATCCCGT |
| Internal bar code: | GCGTGCGGAATTTGTAGTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 30 |
| LEAP-Seq percent confirming: | 55.5402 |
| LEAP-Seq n confirming: | 401 |
| LEAP-Seq n nonconfirming: | 321 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTTAGATTCCGCGTGCTC |
| Suggested primer 2: | ACACAACACGTGCGTAGCTC |