Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.078868 |
Chromosome: | chromosome 10 |
Location: | 3037602 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441250 | TMEM231 | (1 of 1) K19362 - transmembrane protein 231 (TMEM231); Transmembrane protein 231 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCTGTAACCAGAAGGCTTCAGTCTCGTC |
Internal bar code: | GTGCGCAGCTTCAATAGGGAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 537 |
LEAP-Seq percent confirming: | 82.3096 |
LEAP-Seq n confirming: | 1675 |
LEAP-Seq n nonconfirming: | 360 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGTCCGTCAAACGTGTTC |
Suggested primer 2: | GGTTCTGCAAACACGGAAGT |