| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.078891 |
| Chromosome: | chromosome 6 |
| Location: | 3049663 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g274400 | SMM19 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) 2.1.1.244 - Protein N-terminal methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCCTCCTTCCCATCCTCCTGCCTCCT |
| Internal bar code: | TGTCGATGGCAGGGATGGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 7 |
| LEAP-Seq percent confirming: | 87.561 |
| LEAP-Seq n confirming: | 359 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTGACGAATATGAGCCC |
| Suggested primer 2: | GCTTCACCACGCCTTGTAAT |