| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.078932 |
| Chromosome: | chromosome 7 |
| Location: | 1471644 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323550 | PUS8 | (1 of 2) 5.4.99.19 - 16S rRNA pseudouridine(516) synthase / 16S RNA Psi(516) synthase; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGGGGCACGAGGTTTGGACTTCTGGG |
| Internal bar code: | ATCTAATGTTGAGCTATTTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 327 |
| LEAP-Seq percent confirming: | 98.5714 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAAGTGAAGGCGTAGGCA |
| Suggested primer 2: | GTGCGTGTGTGAGTTAGCGT |