| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.078956 |
| Chromosome: | chromosome 11 |
| Location: | 1139572 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467682 | (1 of 2) IPR005645//IPR029058 - Serine hydrolase FSH // Alpha/Beta hydrolase fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCTGGCCGCCAGACAAGGCTCGCGTGT |
| Internal bar code: | TCACCGATGTCCAAGCTAATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 250 |
| LEAP-Seq percent confirming: | 11.7647 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCGTACAGGCCACTCCAT |
| Suggested primer 2: | CAACTTCAACCAGACCCGTT |