| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.078960 |
| Chromosome: | chromosome 12 |
| Location: | 7220907 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558400 | TRR2 | (1 of 1) K00773 - queuine tRNA-ribosyltransferase [EC:2.4.2.29] (tgt, QTRT1); Queuine tRNA-ribosyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAAGTGCTGTGGTATTGACCCACTCCA |
| Internal bar code: | GGCGGGGCTCAGCAATGACACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 271 |
| LEAP-Seq percent confirming: | 66.2319 |
| LEAP-Seq n confirming: | 3605 |
| LEAP-Seq n nonconfirming: | 1838 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTAAGCAGACAGCAAACA |
| Suggested primer 2: | ATCAAGGAGACCATCGCATC |