| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079016 |
| Chromosome: | chromosome 8 |
| Location: | 2373596 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g370850 | UBC18,RCE1 | RUB1/NEDD8 E2 conjugating enzyme; (1 of 1) K10579 - ubiquitin-conjugating enzyme E2 M (UBE2M, UBC12) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGCAAGCCGCTGCGGGCCTACACCTTC |
| Internal bar code: | TCGGACCACACATCCGGGGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 120 |
| LEAP-Seq percent confirming: | 91.3389 |
| LEAP-Seq n confirming: | 9544 |
| LEAP-Seq n nonconfirming: | 905 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTCCATCATCCACTAGGT |
| Suggested primer 2: | GGAGATAGGGCGTGTGTGTT |