| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079081 |
| Chromosome: | chromosome 11 |
| Location: | 3487745 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481250 | (1 of 1) PTHR10992//PTHR10992:SF699 - ALPHA/BETA HYDROLASE FOLD-CONTAINING PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCGCTTTCCTATACCGCTGCACCCCTC |
| Internal bar code: | AGGGCAAAGAGCATGGTGATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 172 |
| LEAP-Seq percent confirming: | 78.3238 |
| LEAP-Seq n confirming: | 5084 |
| LEAP-Seq n nonconfirming: | 1407 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGTTGGATTGGAGAACA |
| Suggested primer 2: | CACACACAATCGCAATCACA |