| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079105 |
| Chromosome: | chromosome 8 |
| Location: | 613955 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359750 | RPS9 | Ribosomal protein S9, component of cytosolic 80S ribosome and 40 | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTCTTGCTGCGCCGCGGCCTCGACCTC |
| Internal bar code: | CCCGTGGATCCCCTCCGGAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 98.4118 |
| LEAP-Seq n confirming: | 3284 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCTGTGAACCAGGTTTT |
| Suggested primer 2: | GACAGCCAGAAGCACATTGA |