Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.079152 |
Chromosome: | chromosome 17 |
Location: | 1620777 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g708000 | FAP260 | Membrane-associated Flagellar Associated Protein 260; (1 of 11) PF13426 - PAS domain (PAS_9) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCCCTCGGGAAAGCACCAGCGGCCGGG |
Internal bar code: | TCGTCGTAAGACAGCCGCATACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 442 |
LEAP-Seq percent confirming: | 99.5658 |
LEAP-Seq n confirming: | 688 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGCTGGAGGCTACACTG |
Suggested primer 2: | ACTATCACCGTCCAACTGGC |