| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079155 |
| Chromosome: | chromosome 3 |
| Location: | 4244592 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174100 | (1 of 1) IPR013122//IPR015928 - Polycystin cation channel, PKD1/PKD2 // Aconitase/3-isopropylmalate dehydratase, swivel | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTGCATGCGTACCGTTGAAGCCAGCT |
| Internal bar code: | ACGCGATCGAATCCCCCGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 641 |
| LEAP-Seq percent confirming: | 96.4451 |
| LEAP-Seq n confirming: | 2713 |
| LEAP-Seq n nonconfirming: | 100 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGATGAACACTTGCACGC |
| Suggested primer 2: | GAGCAGTAGGAGCAAATGGC |