| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.079175 |
| Chromosome: | chromosome 13 |
| Location: | 4167375 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592050 | DAL1 | Allantoinase; (1 of 1) 3.5.2.5 - Allantoinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTATCGCATGTGCCCAGGATCCCGAAC |
| Internal bar code: | ACGCCTCGCTTATGATGAACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 82 |
| LEAP-Seq percent confirming: | 97.9798 |
| LEAP-Seq n confirming: | 97 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGGACAAGGACCGCTAC |
| Suggested primer 2: | ACCGGTTTCATTTTGCTACG |