| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.079222 |
| Chromosome: | chromosome 3 |
| Location: | 4494065 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176250 | ATPVD1 | (1 of 1) K02146 - V-type H+-transporting ATPase subunit d (ATPeV0D, ATP6D); Vacuolar ATP synthase subunit D | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAATCTGGCACACCCCTTGCCGTGGCAT |
| Internal bar code: | TGAGGATGGCGTTGCCCAGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 99.5622 |
| LEAP-Seq n confirming: | 1137 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACGAATGTGTTTCGGGA |
| Suggested primer 2: | TCGAGTTCAGCGTGATGTTC |