Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.079222 |
Chromosome: | chromosome 3 |
Location: | 4494065 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g176250 | ATPVD1 | (1 of 1) K02146 - V-type H+-transporting ATPase subunit d (ATPeV0D, ATP6D); Vacuolar ATP synthase subunit D | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACGCCACGCCCATGCCGCGATTGCGGC |
Internal bar code: | CGCGCGACTTTAACGGTCTGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1063 |
LEAP-Seq percent confirming: | 99.7643 |
LEAP-Seq n confirming: | 5926 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACGAATGTGTTTCGGGA |
Suggested primer 2: | TCGAGTTCAGCGTGATGTTC |