| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.079227 |
| Chromosome: | chromosome 10 |
| Location: | 2192620 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433750 | PAP1 | Class-I Nucleotidyl-transferase 1, nuclear; (1 of 1) K14376 - poly(A) polymerase (PAP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGACAAGGTCGTTGGACCTTGTTCTTA |
| Internal bar code: | GTTGTCACACGCTTTGTATTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1180 |
| LEAP-Seq percent confirming: | 98.5604 |
| LEAP-Seq n confirming: | 5340 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGTTCACTCCGATCCCA |
| Suggested primer 2: | TGTTGATGACGCTGGAGAAG |