Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.079227 |
Chromosome: | chromosome 10 |
Location: | 2192620 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g433750 | PAP1 | Class-I Nucleotidyl-transferase 1, nuclear; (1 of 1) K14376 - poly(A) polymerase (PAP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGACAAGGTCGTTGGACCTTGTTCTTA |
Internal bar code: | GTTGTCACACGCTTTGTATTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1180 |
LEAP-Seq percent confirming: | 98.5604 |
LEAP-Seq n confirming: | 5340 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTAGTTCACTCCGATCCCA |
Suggested primer 2: | TGTTGATGACGCTGGAGAAG |