| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079255 |
| Chromosome: | chromosome 3 |
| Location: | 4375792 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175351 | LMR2 | (1 of 14) PF01476 - LysM domain (LysM); Predicted protein with LysM domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTTACATAGTTCATCAGCTACATACGT |
| Internal bar code: | GTGGTGGGCCGGGGTGGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 624 |
| LEAP-Seq percent confirming: | 99.1214 |
| LEAP-Seq n confirming: | 1241 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCGACATTCCTTAACTGC |
| Suggested primer 2: | AATAAGGTCTTGCCCGTGTG |