| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.079265 |
| Chromosome: | chromosome 14 |
| Location: | 2520161 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625300 | CAX3 | (1 of 1) PTHR12266//PTHR12266:SF9 - NA+/CA2+ K+ INDEPENDENT EXCHANGER // CATION/CALCIUM EXCHANGER 3-RELATED; CAX family cation antiporter, membrane protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAATAGTATATATTTGCGGATTGGAAC |
| Internal bar code: | ACCCCTGCTAAGTTGCCGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 837 |
| LEAP-Seq percent confirming: | 98.0823 |
| LEAP-Seq n confirming: | 4552 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAAGTGAAGGCGTAGCCA |
| Suggested primer 2: | TCCTCCCTCAACACAGATCC |