| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.079286 |
| Chromosome: | chromosome 8 |
| Location: | 369888 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358572 | (1 of 5) PF03094 - Mlo family (Mlo) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCGCATGCGGTCCTCCTCCGCGCGCTT |
| Internal bar code: | CGTAAACTCAAAGCTGTGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 229 |
| LEAP-Seq percent confirming: | 94.302 |
| LEAP-Seq n confirming: | 662 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACACCCACTGGTTCTGG |
| Suggested primer 2: | ACTCACCTCCTCACCCCAC |