| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.079336 |
| Chromosome: | chromosome 4 |
| Location: | 2408032 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g221250 | (1 of 1) PF11378 - Protein of unknown function (DUF3181) (DUF3181) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCAACAAGACGCCGTACGAGGAGTTC |
| Internal bar code: | AAATTAGGTGAAGGTCTATCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 124 |
| LEAP-Seq percent confirming: | 93.0041 |
| LEAP-Seq n confirming: | 452 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCGTCTCGTGTTCGTTA |
| Suggested primer 2: | ACGAGGGCTACCCACTACCT |