Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.079336 |
Chromosome: | chromosome 4 |
Location: | 3045801 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g225200 | FAP311 | Flagellar Associated Protein 311; (1 of 5) PF13374 - Tetratricopeptide repeat (TPR_10) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCGTCTAATCATGATTGTAATACATAC |
Internal bar code: | GCTAAGCCGACCCGCCGTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 7 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACACACACGCAC |
Suggested primer 2: | CCGTGTGTGTGTGTGTGTGT |