Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.079341 |
Chromosome: | chromosome 9 |
Location: | 3647613 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390430 | (1 of 1) K13108 - smad nuclear-interacting protein 1 (SNIP1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCACCACGTCCTTCTCCAACAGCTCGT |
Internal bar code: | GAGTCGCGGGTGAAGAGGGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 749 |
LEAP-Seq percent confirming: | 98.4932 |
LEAP-Seq n confirming: | 1961 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGCCAGTGACTTGTTGT |
Suggested primer 2: | CATGTGAAAATGGCAGGTTG |