| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.079342 |
| Chromosome: | chromosome 12 |
| Location: | 3282147 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498100 | EIF3E | (1 of 1) K03250 - translation initiation factor 3 subunit E (EIF3E, INT6); Eukaryotic translation initiation factor 3, subunit E | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGATCCGTGCAGCAGCCGTCGCCAGCGCT |
| Internal bar code: | CGCGGGATTAGTCTATAACGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 418 |
| LEAP-Seq percent confirming: | 97.664 |
| LEAP-Seq n confirming: | 5644 |
| LEAP-Seq n nonconfirming: | 135 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTGCACTACGACTTCGAC |
| Suggested primer 2: | TTTCAGTCTCGTTGGCACAG |