| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.079363 |
| Chromosome: | chromosome 15 |
| Location: | 806624 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639850 | NCL6,OPR96 | Nuclear Control of chloroplast Like 6, pseudogene; (1 of 45) IPR013584 - RAP domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGGCGTGGGCCCTTGCTAAGATGGGTT |
| Internal bar code: | GTCAGGTGACCGCGTTACTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 804 |
| LEAP-Seq percent confirming: | 62.1395 |
| LEAP-Seq n confirming: | 1185 |
| LEAP-Seq n nonconfirming: | 722 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTTTCGGTTGTAGAGG |
| Suggested primer 2: | GATCCTGAGGTCCTTGTGGA |