Insertion junction: LMJ.RY0402.079538_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.079538
Chromosome:chromosome_10
Location:1651713
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCCGCCCGACTCCAGGTTGATGCGGATGT
Internal bar code:AATGGCACGCATTACTTCCCCA

Confirmation - LEAP-Seq

LEAP-Seq distance:10
LEAP-Seq percent confirming:43.369
LEAP-Seq n confirming:1501
LEAP-Seq n nonconfirming:1960
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:GTGCTACCACCTGTCTGCAA
Suggested primer 2:CGTGTGTGTGTGGTGTGTGT