| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.079740 |
| Chromosome: | chromosome 3 |
| Location: | 1303861 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150400 | PIGU1,PIGU,LRG5 | GPI transamidase subunit PIG-U; (1 of 1) K05293 - phosphatidylinositol glycan, class U (PIGU) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGGTTGGGGCGGTTGGGCGGTTTTAGGG |
| Internal bar code: | GGCTATGTTCGGTGACCGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 98 |
| LEAP-Seq percent confirming: | 99.8206 |
| LEAP-Seq n confirming: | 8346 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATCGGAGAGAGAGGCTTG |
| Suggested primer 2: | CGACGGTAAGAGGTCGAGAG |