Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.079808 |
Chromosome: | chromosome 7 |
Location: | 4007708 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339900 | MAPKKK5 | Mitogen-Activated Protein Kinase Kinase Kinase; (1 of 18) 2.7.10.2//2.7.11.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCTCTCCTCCTTCTCCATTTGTTAGCT |
Internal bar code: | TGGAATCGAATTGGGGCGCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 651 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCCTTCCAGTGACAAGTA |
Suggested primer 2: | GCCGCTTTGCTTATTCTTTG |