| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.079849 |
| Chromosome: | chromosome 5 |
| Location: | 1134890 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245700 | ANK25 | (1 of 4) PF06985//PF12796 - Heterokaryon incompatibility protein (HET) (HET) // Ankyrin repeats (3 copies) (Ank_2); Predicted protein with ankyrin repeats | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTTCCCCCCCTGCCCCTGTACCATGTC |
| Internal bar code: | CGGAGAACTATTTCTTTATACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 419 |
| LEAP-Seq percent confirming: | 99.6878 |
| LEAP-Seq n confirming: | 13093 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGAAGGGGAGGGGTGAAG |
| Suggested primer 2: | CAAGGGTGTGGTGACAACTG |