Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.080136 |
Chromosome: | chromosome 1 |
Location: | 1669075 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g008850 | HLM2 | (1 of 1) PF12931//PF12932 - Sec23-binding domain of Sec16 (Sec16_C) // Vesicle coat trafficking protein Sec16 mid-region (Sec16); Histone-lysine N-methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGGGTGCCGCCCGCCGCACACGCTCTC |
Internal bar code: | GATGGGCGCTGACCGGCAGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 199 |
LEAP-Seq percent confirming: | 85.0467 |
LEAP-Seq n confirming: | 910 |
LEAP-Seq n nonconfirming: | 160 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGATCACACGCAGCAAC |
Suggested primer 2: | AACAGCAGTACCAGCAGCCT |