Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.080177 |
Chromosome: | chromosome 9 |
Location: | 4784993 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g397327 | (1 of 1) PTHR11139:SF68 - DNA-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCAACCATGGGGCGCCAAGGGAACTTCC |
Internal bar code: | CTACAACCGGTCGAGGCAAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 141 |
LEAP-Seq percent confirming: | 99.2974 |
LEAP-Seq n confirming: | 424 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGATCAAGTCAAGGTGCGA |
Suggested primer 2: | ATTCAAACGTGTGCCAACAG |