Insertion junction: LMJ.RY0402.080201_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.080201
Chromosome:chromosome_6
Location:1197574
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g257600 FA1 Flagellar Autonomy Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTCTGGCTCATCGCAAGCGTGTTAGGTCCA
Internal bar code:GGCACCTGGCAGTTGGGTAGTA

Confirmation - LEAP-Seq

LEAP-Seq distance:128
LEAP-Seq percent confirming:99.005
LEAP-Seq n confirming:199
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:CTAGCACAAGAGGGACGGAG
Suggested primer 2:CAGCAATCTCTGCCCCTTAG