| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.080277 |
| Chromosome: | chromosome 2 |
| Location: | 2717151 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093600 | TEH3 | (1 of 6) PF03061 - Thioesterase superfamily (4HBT); Thioesterase-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGAACGTACACAGCTGCCTTTTGTGATT |
| Internal bar code: | TCGAAGCGACTTTGATATGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 561 |
| LEAP-Seq percent confirming: | 98.8098 |
| LEAP-Seq n confirming: | 4898 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTTGTAACGCCTCGTCA |
| Suggested primer 2: | CACAGGTCGCTAACCAGACA |