| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.080322 |
| Chromosome: | scaffold 26 |
| Location: | 46043 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre26.g756897 | (1 of 1) IPR000104//IPR003903 - Antifreeze protein, type I // Ubiquitin interacting motif | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCACCTCCCCTCCACCTCTTCACCCA |
| Internal bar code: | GGAAGGGGGGAGGGGCGCAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAAGGAGGGGACGGCTG |
| Suggested primer 2: | ATCATGTCCAGGTCTACGGG |