Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.080368 |
Chromosome: | chromosome 16 |
Location: | 2057862 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657200 | GOX17,GOX18 | (1 of 12) 1.1.3.9 - Galactose oxidase / Beta-galactose oxidase; Glyoxal oxidase 17 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTGGCTACTATTGCCCGGCGGCAACTGG |
Internal bar code: | AAGGACCAGCATATCCGATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 429 |
LEAP-Seq percent confirming: | 99.6199 |
LEAP-Seq n confirming: | 22804 |
LEAP-Seq n nonconfirming: | 87 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTTGCTCTCCTCCAGTCC |
Suggested primer 2: | ATCACTACGCCTTACCCACG |