| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.080491 |
| Chromosome: | chromosome 9 |
| Location: | 1049694 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400750 | AMT5,AMT1Ea,AMT1E | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACACACGGGGCTTTTCGGGAGCCGCTT |
| Internal bar code: | TGGTCACGCGAGGTGCTAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 98.8402 |
| LEAP-Seq n confirming: | 4602 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCCTCCTCATCATCAAA |
| Suggested primer 2: | GTCAAGGTAGCCAGAGGCAG |