| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.080494 |
| Chromosome: | chromosome 3 |
| Location: | 4358823 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175200 | TOC75 | Translocon at the outer envelope membrane of chloroplasts, 75 kDa subunit; (1 of 2) PTHR12815//PTHR12815:SF7 - SORTING AND ASSEMBLY MACHINERY SAM50 PROTEIN // OUTER ENVELOPE PROTEIN 80, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATGTTCGGCCTTGCGGCATCATGGCATC |
| Internal bar code: | TGGGCTGTTGCAACGACCCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 977 |
| LEAP-Seq percent confirming: | 99.3428 |
| LEAP-Seq n confirming: | 6802 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGACCCTGCTGCTTTCGT |
| Suggested primer 2: | GGCGTACGACTACTTCTCGC |