Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.080507 |
Chromosome: | chromosome 13 |
Location: | 2190847 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g578350 | MPA11 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 3) 3.1.3.26 - 4-phytase / Phytate 6-phosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGATATGTGCACGCAAAATCCATCCTT |
Internal bar code: | GAGGCTTCGATCCCGCCCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 671 |
LEAP-Seq percent confirming: | 99.0569 |
LEAP-Seq n confirming: | 3466 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCATGGCCCACTGGTACT |
Suggested primer 2: | CCGATGATCTTGACGGTTCT |