| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.080527 |
| Chromosome: | chromosome 7 |
| Location: | 2170208 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g326800 | PPP29,PP5,CCPP5 | Co-chaperone protein p5 of HSP90; (1 of 1) PTHR11668:SF21 - SERINE/THREONINE-PROTEIN PHOSPHATASE 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGAGCATAGTGATGTAGAGGAGGGCGTG |
| Internal bar code: | TGGGGTTTCCAGAGGCCAATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 99.687 |
| LEAP-Seq n confirming: | 5096 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCAGTCGTTGTTTCAGTA |
| Suggested primer 2: | GTGCCCGGATGAGGTATCTA |