Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.080529 |
Chromosome: | chromosome 9 |
Location: | 2829152 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g388750 | TEF21 | (1 of 1) PTHR11200:SF170 - PHOSPHOINOSITIDE PHOSPHATASE SAC1; Phosphoinositide phosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGATCGCCCGGGACTGTGCCCCAAGGT |
Internal bar code: | TGGGGCCGGGCGAGCTGATTCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 47 |
LEAP-Seq percent confirming: | 92.4812 |
LEAP-Seq n confirming: | 123 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGACAAGAACAGTGCCAA |
Suggested primer 2: | GTTTGGTGGTAGTGGCGAAT |