| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.080554 |
| Chromosome: | chromosome_6 |
| Location: | 1388555 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre06.g258800 | CWP2,GP2 | Hydroxyproline-rich glycoprotein component of the outer cell wal | antisense | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | ACGGAATTCAATTTCGCTCGTCCAAGCGCC |
| Internal bar code: | GGAGTGGAGTTAACCCACTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 622 |
| LEAP-Seq percent confirming: | 97.1061 |
| LEAP-Seq n confirming: | 302 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATTTTGGGGGTGAATGAA |
| Suggested primer 2: | GAAGCTCAAGGCTGTGTTCC |