| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.080594 |
| Chromosome: | chromosome 11 |
| Location: | 3234716 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479650 | CHIP,CHIP1 | (1 of 1) K09561 - STIP1 homology and U-box containing protein 1 (STUB1, CHIP); Carboxyl terminus of Hsc70-interacting protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGGAGGAGCATCCGTGGGGCTGGGCTGA |
| Internal bar code: | AGGGATTACGAGTCAAATTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 732 |
| LEAP-Seq percent confirming: | 99.116 |
| LEAP-Seq n confirming: | 1906 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGATGAACAAGCACAGGA |
| Suggested primer 2: | TCAATTTGCTGCAGAACGTC |