| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.080726 |
| Chromosome: | chromosome 15 |
| Location: | 1273900 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g641650 | HLM22 | (1 of 4) PTHR10887:SF331 - HELICASE MOV10L1-RELATED; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGGCAATGTTGGATGGAATGTTGTTGA |
| Internal bar code: | CCTCGACAAATTCCACTACAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 298 |
| LEAP-Seq percent confirming: | 84.6839 |
| LEAP-Seq n confirming: | 2947 |
| LEAP-Seq n nonconfirming: | 533 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCTTGACTGTCCTAACCG |
| Suggested primer 2: | CAAACACCTCGAGAGCCTTC |