| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.080888 |
| Chromosome: | chromosome 3 |
| Location: | 1635994 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152950 | PUS12 | (1 of 1) 4.2.1.70//5.4.99.12 - Pseudouridylate synthase / Uracil hydrolyase // tRNA pseudouridine(38-40) synthase / tRNA pseudouridylate synthase I; RNA pseudouridine synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGTGAAGACTCCGCTAGCGTCATGAT |
| Internal bar code: | CACCCCGATGAGTTGTCGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 671 |
| LEAP-Seq percent confirming: | 99.3429 |
| LEAP-Seq n confirming: | 7408 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGTGAGCTGATGCCGACT |
| Suggested primer 2: | AAACCAAAAAGCGACCACAG |