Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.080954 |
Chromosome: | chromosome 4 |
Location: | 423406 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217920 | (1 of 41) PTHR32523//PTHR32523:SF8 - FAMILY NOT NAMED // PHYTOL KINASE 1, CHLOROPLASTIC | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATTTCGTGTCCCACGGGCCCGTCGTCAT |
Internal bar code: | AAACATGGTGGATCGTGAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 723 |
LEAP-Seq percent confirming: | 99.0307 |
LEAP-Seq n confirming: | 2452 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGATGGGTAACGTTTGGGTG |
Suggested primer 2: | ACTTTTGCCGCCACAATATC |