| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081026 |
| Chromosome: | chromosome 14 |
| Location: | 2797336 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g627350 | XYI3 | Sulfite exporter family protein; (1 of 4) PTHR14255:SF3 - SULFITE EXPORTER TAUE/SAFE FAMILY PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCTACTCCCCGCTCCTCGCCTCCGCT |
| Internal bar code: | AATTCGGGGGTCCGTAATGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 28 |
| LEAP-Seq percent confirming: | 40.2968 |
| LEAP-Seq n confirming: | 1086 |
| LEAP-Seq n nonconfirming: | 1609 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCCCTTCTTGCTACGC |
| Suggested primer 2: | GGGGAGGGGACTAATTACCA |