Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.081035 |
Chromosome: | chromosome 10 |
Location: | 1798865 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g430950 | RAD54B,SRH18 | (1 of 1) K10875 - DNA repair and recombination protein RAD54 and RAD54-like protein (RAD54L, RAD54); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTGCCCCAGGGCCGCCTGACGACGCTG |
Internal bar code: | GGAAAACGAACGAGCTTGCTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 629 |
LEAP-Seq percent confirming: | 99.5155 |
LEAP-Seq n confirming: | 1027 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCTTCCCTATCCAGTACG |
Suggested primer 2: | ACGCATAACTGCATAAGGGC |