| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.081066 |
| Chromosome: | chromosome 10 |
| Location: | 5860238 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g461750 | DMC5 | Putative DNA methylase; (1 of 1) PF00145//PF12047 - C-5 cytosine-specific DNA methylase (DNA_methylase) // Cytosine specific DNA methyltransferase replication foci domain (DNMT1-RFD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCATTGCCCATCATATGATCAGGTGGT |
| Internal bar code: | GGGGGCCCAGATAATTTGTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 567 |
| LEAP-Seq percent confirming: | 97.711 |
| LEAP-Seq n confirming: | 12166 |
| LEAP-Seq n nonconfirming: | 285 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTTCACCACTCAGGTCCG |
| Suggested primer 2: | CAGTTGTGCAAAGACGAGGA |