| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.081227 |
| Chromosome: | chromosome 1 |
| Location: | 6780624 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048850 | (1 of 1) PF01342//PF01388 - SAND domain (SAND) // ARID/BRIGHT DNA binding domain (ARID) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGAGGGGGTAAGGCATGATGCGGGTGA |
| Internal bar code: | AATGAGATGCCCCGGCTTCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 468 |
| LEAP-Seq percent confirming: | 98.5204 |
| LEAP-Seq n confirming: | 2730 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGCTAAGAAAGTTTGGGA |
| Suggested primer 2: | TCATGATGGCTGCTGTTAGC |